Write a method that shows the list of the codons and how many times each codon that appears in a DNA segment.

(*)You may use vector, set, or map containers in order to create a hash table and store frequency values of each codon that appears in the given DNA segment.

Reference: https://www.nature.com/scitable/definition/codon-155

For example:

tacgagcgtgtgctgaaacaaatgaagggccgctacgataaggaacttcgtaatttcaga

would produce

tac => 2
agc => 1
cgt => 2
tca => 1
taa => 2
tcg => 1
gta => 1
gat => 1
tgt => 1
ctt => 1
ctg => 1
gaa => 3
aat => 2
caa => 1
gga => 1
ata => 1
atg => 1
gcc => 1
ccg => 1
act => 1
acg => 2
ttt => 1
gcg => 1
tga => 2
aac => 2
ggc => 1
cga => 2
cag => 1
cgc => 1
agg => 2
aga => 1
aag => 2
aaa => 2
att => 1
ttc => 2
aca => 1
cta => 1
gtg => 2
gct => 2
tgc => 1
ggg => 1
gag => 1
Academic Honesty!
It is not our intention to break the school's academic policy. Posted solutions are meant to be used as a reference and should not be submitted as is. We are not held liable for any misuse of the solutions. Please see the frequently asked questions page for further questions and inquiries.
Kindly complete the form. Please provide a valid email address and we will get back to you within 24 hours. Payment is through PayPal, Buy me a Coffee or Cryptocurrency. We are a nonprofit organization however we need funds to keep this organization operating and to be able to complete our research and development projects.