1) Compute the Number of Times a Pattern Appears in a Text : eg Count(GCGCG,GCG)=2

2) Find the Most Frequent Words in a String:

Given: A DNA string Text and an integer k.
Return: All most frequent k-mers in Text (in any order).
Eg: ACGTTGCATGTCGCATGATGCATGAGAGCT,4
Output= CATG GCAT

3) Find the Complement of a String and reverse the compliment : string only contains letters A,T,C,G.

So A's compliment is C & T's compliment is G.

So replace all A's with C & C's with A , and T's with G's and G's with A.

After that reverse the whole string.

Eg :AAAACCCGGT
output: ACCGGGTTTT

4) Find Patterns Forming Clumps in a String:

Given integers L and t, a string Pattern forms an (L, t)-clump inside a (larger) string Genome if there is an interval of Genome of length L in which Pattern appears at least t times. For example, TGCA forms a (25,3)-clump in the following Genome:

gatcagcataagggtcccTGCAacattggttagaggttgttttacgatcagcataagggtccc TGCAaTGCAttTGCAgttgttttac
Academic Honesty!
It is not our intention to break the school's academic policy. Posted solutions are meant to be used as a reference and should not be submitted as is. We are not held liable for any misuse of the solutions. Please see the frequently asked questions page for further questions and inquiries.
Kindly complete the form. Please provide a valid email address and we will get back to you within 24 hours. Payment is through PayPal, Buy me a Coffee or Cryptocurrency. We are a nonprofit organization however we need funds to keep this organization operating and to be able to complete our research and development projects.